Advertisement
If you have a new account but are having problems posting or verifying your account, please email us on hello@boards.ie for help. Thanks :)
Hello all! Please ensure that you are posting a new thread or question in the appropriate forum. The Feedback forum is overwhelmed with questions that are having to be moved elsewhere. If you need help to verify your account contact hello@boards.ie
The Origin of Specious Nonsense. Twelve years on. Still going. Answer soon.
Options
Comments
-
-
-
-
-
-
Advertisement
-
Both Dembski and Shannon are correct ... but they are talking about totally different things ... Dembski is talking about CFSI (Complex Functional Specified Information) whilst Shannon is talking about the quantification, compression, storage, and communication of all forms of information ... including non-complex, non-functional, non-specified information.
No, once again you've got this completely wrong.
Firstly, there's no suggestion here about Shannon being right or wrong. His equations merely provide the mechanism for evaluating information content. It is a tool. What is in question here is Dembski's concept of complex specified information. That is what is wrong. Dembski uses complex specified information to mean genetic information with low Kolmogorov complexity. He then goes on to claim that such information can only be destroyed and not added to by naturalistic processes. He is doubly wrong.
Firstly, as I outlined in my last post, complex specified information is actually genetic information with high Kolmogorov complexity. Mutation increases this because it increases the variation between specimens. It is this variation which drives natural selection.
Let's use an analogy to explain this. A lot of modern communications is transmitted via fibre optic cabling. This involves transmitting a signal using light waves. If you transmit a single frequency of light down the cable then it doesn't matter how many different sources for that light there are because there is no difference between them. If instead we use multiple sources with slightly different frequenciess then we get a series of pulses because there will be points at which the different wavelengths cancel each other out. These pulses can then be used to transmit digital information based on whether there is a pulse of light being received or not. By adjusting the number of sources and their frequencies you can maximise the bandwidth (i.e. total transmission rate) of the information you're trying to send (approx. 1.2 petabits/second for fibre optics). For anyone who wants a visual example of this here's a good video from Sixty Symbols:
Evolution works on the same principlee. Mutations increase the variation and (from my last post) the genetic information in the population. This is what drives natural selection. It is a well studied topic and there are several good papers which explain this in more detail, such as this one:
Evolution of Biological Complexity
I mentioned above that Dembski is doubly wrong. Even, if he were correct about CSI and Kolmogorov complexity, which he isn't, his idea about CSI being destroyed by mutation would only hold if the only modes of mutation were indels (insertions or deletions) of single nucleotides or frameshift mutations. However, that's not at all true. Quite often, mutation happens at a level above the nucleotide sequence such as gene duplication, chromosome duplication, chromosomal fusion and whole genome duplication (polyploidy). We have examples of all of these mutations where Dembski's ideas of CSI don't even come into play:
Chromosomal fusion
Origin of human chromosome 2: An ancestral telomere-telomere fusion
Whole genome duplication (polyploidy)
A model for the establishment of polyploidy in plants
Chromosomal duplication (aneuploidy)
Segmental aneuploidy and the genetic gross structure of the drosophila genome
Gene Duplication
The Evolution of Functionally Novel Proteins after Gene DuplicationSays who? ... and how?
If carbon was indeed created within a star, the temperatures and pressures would have been such that it would have been ejected as the diamond metastable allotrope of Carbon ... and not the biologically useful forms of carbon, found in carbon dioxide, sugars, etc.
... and we'd all be eating diamonds ... instead of dinner !!!:)
Astrophysics, really? It's time consuming enough correcting your mistakes in biology and theology, did you really have to embarrass yourself in another discipline.
There are so many different things wrong with your statement above that it's difficult to decide which one to start with.
The first problem is that not all stars are the same. Because of the relationship between solar mass and the eventual death of a star there are many different outcomes once a star's hydrogen level decreases to the point that it moves off the main sequence. This is a long and detailed topic but this picture might help to visualise the problem:
Both the dominant energy production process during the main sequence and the triple-alpha process, by which carbon is produced, is highly dependent on temperature, solar mass and density. Because of the variations in these values among stars, we end up with a wide variety of outcomes.
The triple-alpha process is the process in a star by which carbon is produced. During the main sequence, helium accumulates in the stellar core. Eventually, 3 helium nuclei (hence triple alpha) combine to form a carbon nucleus (with the intermediate step of 2 helium nuclei forming a beryllium nucleus). Depending on the mass of the star and other factors like the radiative pressure and electrodegeneracy pressure this carbon can be changed into other carbon forms or carbon compounds before being ejected from the star. By studying meteorites from stellar ejecta we have found carbon in the form of graphite, carbon and silicon carbide.
Your claim hinges on all of the carbon in a star being held in that star without being further converted to oxygen or ejected from the star and where the pressure inside the star is sufficient to transform this carbon into diamond. While this is possible, it's very rare compared to other allotropes of carbon.
Like I said already this is a detailed topic and it's not possible to explain the depths of JC's wrongness without creating a "turgid wall of text" so for anyone interested, here are a few helpful links which explain the subject in more detail:
Stellar nucleosynthesis
Triple-alpha process
Stellar nucleosynthesis and the isotopic composition of presolar grains from primitive meteorites
Effective pressures in star formation
Nuclear astrophysics: the unfinished quest for the origin of the elements
Now, to get back to your previous point:Creation Scientists investigate the world and report their findings, like all other scientists.
No, to say that creation scientists are "like all other scientists" is demonstrably false.
Let's take the Institute for Creation Research, for example. The ICR describes its mission as:
"ICR exists to conduct scientific research within the realms of origins and earth history, and then to educate the public both formally and informally through graduate and professional training programs, through conferences and seminars around the country, and through books, magazines, and media presentations."
This all sounds perfectly reasonable on the surface. However, in their "About us" section, there is a page titled "Core Principles" which outline the basis of the ICR's worldview and shows just how dissimilar they are to conventional scientists. On this page you can find statements which are both demonstrably wrong and unscientific.
For example:
"The first human beings did not evolve from an animal ancestry, but were specially created in fully human form from the start."
"The universe and life have somehow been impaired since the completion of creation, so that imperfections in structure, disease, aging, extinctions, and other such phenomena are the result of "negative" changes in properties and processes occurring in an originally-perfect created order."
"The Bible, consisting of the thirty-nine canonical books of the Old Testament and the twenty-seven canonical books of the New Testament, is the divinely-inspired revelation of the Creator to man. Its unique, plenary, verbal inspiration guarantees that these writings, as originally and miraculously given, are infallible and completely authoritative on all matters with which they deal, free from error of any sort, scientific and historical as well as moral and theological."
"The biblical record of primeval earth history in Genesis 1-11 is fully historical and perspicuous, including the creation and Fall of man, the Curse on the Creation and its subjection to the bondage of decay, the promised Redeemer, the worldwide cataclysmic deluge in the days of Noah, the post-diluvian renewal of man's commission to subdue the earth (now augmented by the institution of human government), and the origin of nations and languages at the tower of Babel."
An actual group of scientists wouldn't hold such preconceived assumptions or biases. There's nothing wrong with having a set of core principles, but if you want to hold yourself up as a paragon of scientific research and be taken seriously as scientists then these principles should include a commitment to publishing all results, eliminating biases where possible, academic integrity, and of course a declaration of interests, all of which are missing from ICR's website. It is these reasons as well as the unscientific behaviour of the more prominent "creation scientists" which I documented previously which isolate "creation scientists" from the larger scientific community.0 -
-
-
-
-
Advertisement
-
-
-
-
-
-
-
-
-
In general, living CFSI has relatively low Kolmogorov complexity due to the limited combinatorial space for useful biomolecules and the genetic CFSI that produces them.
Mutagenesis will certainly increase its Kolmogorov complexity but at a very high cost in functionality and specificity ... rapidly reaching the point of complete disfunctionality and death.
OK, before we begin let's clear something up. There's no such thing as "complex functional specified information". The concept originally outlined by Dembski is based on the idea of specified complexity which existed in biology before Dembski ever put pen to paper, as it were. Dembski's work is often quoted as complex specified information but adding the word functional into the mix doesn't help your case any, it's just a meaningless term. Apart from two references on a blog and a single forum post the only references on the internet to "complex functional specified information" come from you. Not even other "creation scientists" use the term CFSI. Your problem is that CSI has been so comprehensively torn apart not just on this thread but by a number of actual scientists that you feel that tossing the word functional into the mix is somehow going to negate the fatal flaws in CSI. It isn't.
Now, let's talk specified complexity, Kolmogorov complexity and functionality.
We've already seen that Dembski uses low Kolmogorov complexity as the basis for his idea of complex specified information. However, his total ignorance of biology undermines the concept from the get go. As I've already described low Kolmogorov complexity allows for the information content of a message to be transmitted in an abbreviated form. So if you want to send the following 32 bit string:
ABABABABABABABABABABABABABABABAB
you can just send "AB 16 times" which can take up just 9 bits of information. Dembski's idea is that information with specified complexity i.e. something that is functionally useful for an organism would have a DNA sequence which has low Kolmogorov complexity. He further argues, just as you have done above that mutation increases Kolmogorov complexity at the cost of function. He, and you, are fractally wrong.
Firstly, let's consider a single mutation in the above sequence:
ABABABCBABABABABABABABABABABABAB
Now, we have changed the sequence by just a single letter but we have significantly increased the Kolmogorov complexity. But what does this do to the function of the sequence? Well, in this hypothetical example, nothing because it's just a simplified example, but next let's look at a real example.
On the short arm of chromosome 4 there exists a gene with the following structure:
CAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAG
Now, using Dembski's argument this gene is an example of complex specified information since a) it has low Kolmogorov complexity and b) it has a specific function, i.e. it codes for the protein huntingtin. Dembski's idea is that a mutation in this gene would lead to increased Kolmogorov complexity. Does it? Well, as it turns out no. The structure above is an example of the gene sequence in a healthy adult. Now let's look at two mutated sequences:
1.
CAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGACAGCAGCAGCAGCAG
2.
CAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGACAGCAGCAGCAGCAGCAGCAGCAGCAG
The healthy version of the gene contains repeats of the codon CAG with normally between 6 and 35 repeats. The first mutated example above contains 36 repeats while the second example contains 40 repeats. In the first example, the 36 repeats cause the huntingtin protein to stop working normally and it no longer interacts with other proteins as it normally would. In the second mutated example, a modified huntingtin protein is produced which fragments itself and draws other proteins into lumps forming neuronal intranuclear inclusions which causes the person with the mutated gene to develop Huntington's disease. So we have three examples above of DNA sequences with normal function, no function and harmful function. What about the Kolmogorov complexity. Well, since the sequence is composed of repeats of the same codon, the Kolmogorov complexity for all three sequences is exactly the same, contrary to what Dembski predicts.
There are two more problems with Dembski's CSI idea, one of which we've already touched on and one we haven't.
Firstly, mutation types. In post 2617 I explained why Dembski's CSI idea fails because he believes that mutation happens only through indels (insertions or deletions) of nucleotides or frameshift mutations. It doesn't and mutations like gene duplication or aneuploidy completely obviate Dembski's argument about increasing complexity destroying functionality. Furthermore, we have evidence of novel functionality being acquired through mutation contrary to what Dembski claims.
Emergence of nylon oligomer degradation enzymes in Pseudomonas aeruginosa PAO through experimental evolution.
Evolution of a regulated operon in the laboratory
Evolution of a new enzymatic function by recombination within a gene
These are just 3 examples out of over 3000 papers which detail the acquisition of novel function through gene duplication or mutation types other than those considered by Dembski.
Now, secondly, for the big elephant in the room, redundancy. Dembski (and other creationists) argue the idea that a protein sequence needs to be a certain way, that if you change one letter out of a 100 amino acid sequence then you're going to **** everything up and nothing's going to work anymore. Trouble is he's dead wrong. Just to underscore this problem here's an excerpt of a creationist trying to prove design using Shannon information:
"Complex specified information is a specified subset of Shannon information. That means that complex specified information is Shannon information of a specified nature, ie with meaning and/ or function, and with a specified complexity.
Shannon's tells us that since there are 4 possible nucleotides, 4 = 2^2 = 2 bits of information per nucleotide. Also there are 64 different coding codons, 64 = 2^6 = 6 bits of information per amino acid, which, is the same as the three nucleotides it was translated from.
Take that and for example a 100 amino acid long functioning protein- a protein that cannot tolerate any variation, which means it is tightly specified and just do the math 100 x 6 + 6 (stop) = 606 bits of specified information- minimum, to get that protein. That means CSI is present and design is strongly supported.
Now if any sequence of those 100 amino acids can produce that protein then it isn't specified. IOW if every possible combo produced the same resulting protein, I would say that would put a hurt on the design inference."
I have highlighted the portion of the post where the creationist argument unravels. He fails to take into account redundancy.
Firstly, he mentions that there are 64 possible codons which, irrelevantly, is equal to 2^6. However, what he fails to mention is that these 64 codons produce just 20 amino acids as shown in the table below:
There is a high degree of structural redundancy among codons such that, for example, arginine can be produced by any of the following combinations: CGT, CGC, CGA, CGG, AGA, AGG. This has significant consequences for Dembski's claim about the fragility of protein sequences. Of course, structural redundancy is not just observed at the amino acid level.
Proteins also have a high degree of structural or functional redundancy. Take cytochrome c, for example. Cytochrome c is a hemeprotein which is 100 amino acids long just like in the creationist example above. However, it has a massive degree of structural redundancy as seen in the species comparison below:
As you can see in the image above, you have widely varying amino acid sequences yet each of these sequences result in cytochrome c. In fact, for all 100 unit amino acid sequences (approx. 10^130 possible combinations) 10^67 result in cytochrome c. So Dembski's claim that mutation destroys complex specified information is demonstrably false.
Another example of this phenomenon is haemoglobin. There are over 250 different mutations in the haemoglobin protein which have been documented and yet the function of the protein is unaffected. That's 250 variations of a protein which is only 287 amino acids long in the first place.
This idea is well-documented in the literature being featured even in some textbooks. Some references for those interested:
Cytochromes c: Evolutionary, Structural and Physicochemical Aspects
Protein folding and protein evolution: common folding nucleus in different subfamilies of c-type cytochromes?
Structural and genetic analysis of the folding and function of T4 lysozyme
OK, I think I've taken up enough of everyone's time, time to summarize:- Although Dembski's use of Kolmogorov complexity is the opposite of it's use in mainstream biology, the point is moot since functional and non-functional sequences can and do have the same Kolmogorov complexity.
- Complex specified information only becomes relevant, even theoretically, if we restrict mutation types to indels and frameshift mutations. Since there are other types of mutation which do not operate in this way, the idea of CSI is fatally undermined.
- Even if we consider point mutations, they have little impact on the functionality of proteins owing to the structural redundancy of both amino acids and proteins.
- Mutations can create new CSI/CFSI through the acquisition of novel features such as the development of nylonase
CSI is a house of cards argument that its own author doesn't even bother to defend anymore. It looks all science-y from a distance but once you start to prod it a little the entire argument crumbles and it does so completely.0 -
nozzferrahhtoo wrote: »I think I hold a different understanding of that definition to you. I understand "supernatural" to refer to things that are "beyond scientific understanding or the laws of nature" in terms of them being beyond EVER being understood by science or the laws of nature.
The way you have parsed the definition is to say "supernatural" means anything that is CURRENTLY outside our scientific understanding. So, for example, before we knew the neurological underpinnings of Epilepsy at the level of the brain.... Epilepsy was "supernatural" because it was outside CURRENT scientific understanding.
And I do not think that is the right way to parse the definition of "supernatural" at all. "Supernatural" is about what is BEYOND EVER being understood using science, not what is CURRENTLY beyond being understood by science. Therefore Epilepsy was never "supernatural" even when we did not understand it.
So to call the origins of our universe "supernatural" is to make an assumption that I do not think there is currently a basis to make. So I can but advise you do not make it.
But is it? if we examine actual definitions of what supernatural is, versus what you posit it is, we can equally lend credence to what ive stated ....lets investigate
Merriam Webster definition : of or relating to an order of existence beyond the visible observable universe; especially : of or relating to God or a god, demigod, spirit, or devil
2
a : departing from what is usual or normal especially so as to appear to transcend the laws of nature
b : attributed to an invisible agent (such as a ghost or spirit)
Cambridge : caused by forces that cannot be explained by science
Now, I know that we have no explanation for these things first off, which you don't seem to agree is enough to consider it..but also remember that examining the phenomena in question that could possibly involve moving outside the boundaries of space & time, and with that let us consider Kuhn's words
the reception of a new paradigm often necessitates a redefinition of the corresponding science. Some old problems may be relegated to another science or declared entirely "unscientific." [e.g. alchemy] Others that were previously non-existent or trivial may, with a new paradigm, become the very archetypes of significant scientific achievement. [e.g., tidology, the study of the tides] The normal-scientific tradition that emerges from a scientific revolution is not only incompatible but often actually in-commensurable with that which has gone before
In the above sense, its somewhat plausible to see how the origins of the universe could be viewed as supernatural, as no existing paradigm can account for it, therefore we are left with no natural explanation. Considering the aforementioned its certainly possible that a scientific revolution may occur, which could possibly rewrite much of scientific consensus, thus redefining the supernatural as natural, however we will have to wait and see if that happens..in any event I do see the discrepancy and take what you've mentioned, so imo, you could interpret it whatever way you wish, depending on how you take the definition I guessnozzferrahhtoo wrote: »It is hard to parse what a sentence like that means as quite often when I hear it and I delve further into it's meaning with the speaker..... it turns out what they mean by it is "Stop believing only what you find substantiation for, and open yourself up to believing stuff I have simply made up directly or second hand".
And while YMMV I see nothing "limited" or "limiting" about only lending credence to claims which are presented to me with SOME modicum of argument, evidence, data or reasoning to lend them credence.
I will reframe it to make it easier to understand then. My opinion is dont close yourself off to outside ideas because they dont match up to your beliefs (or lack of), rather take the "I dont know attitude".
So are you saying there's nothing to suggest the actual existence of supernatural phenomena? I'm not accusing here I'm askingnozzferrahhtoo wrote: »Well if I am also welcome to add mine, the answer is simply "I do not know, no one else seems to either, and I consider it an open question at this time".
Certainly however the word "cause" gives me pause because causality is temporal, based on time, and time is an attribute that appears to have come into being "after" the big bang. So when we start talking about "causes" of the big bang or what happened "before" it......... I think we are entering into a realm of discourse outside normal human linguistics because our language is, for good reason, temporal based too.
But whatever the answer turns out to be, assuming we ever find one, I think it will either not be a causal solution, or it will require a whole new model of causality that is independent of a temporal element. Either that or it is universe all the way down, each with a temporal element containing the next.
But, as I said: I do not know, and no one else appears to either. We are, alas, entirely ignorant at this time.
Correct me if I am wrong here, but are you saying that we will need to utilise a method that involves transcending the boundaries of time in order to get these answers?? again I'm asking not presumingnozzferrahhtoo wrote: »And many users are past even bothering to reply to him or be trolled by him, which is why it is always welcome to have another like your good self enter the thread to lend some new life to the discussion.
And I hope not too many users, and I hope you can forgive them, transfer their snidery on to you from him until such time as it is warranted to do so. But alas yes, there are those who will jump on any creationist (or similar) that comes into this thread as if they are just another head of the same snake.
I trust you will find my own response above that, and you will return the decorum in the spirit it is offered.
Indeed I donozzferrahhtoo wrote: »Well as I said above, we simply do not know if time was an element in the original creation or formation of our universe. It is just not knowledge we have. What we certainly do NOT have at this time is any model of causality without a temporal element, so really at this point we do not even have the LANGUAGE (aside, I suppose, for the language of mathematics) let alone the actual evidence and knowledge, to really talk about it outside the realm of navel gazing and guesswork.
The only other thing I can say with any certainty after that is that WHATEVER the explanation for our universe is..... we at this time do not appear to have even a shred of a tiny modicum of argument, evidence, data or reasoning to suggest that the explanation lies in the workings of a non-human intelligent or intentional agent. Or a "god" if you will.
To my knowledge anyway. If you ARE are of any such thing I have missed, you are more than invited to adumbrate it for me now. Clearly you have indicated in your most recent post you have a "faith" in such an intentional creation agent, but I would be interested if that is grounded in anything more substantive than the mere whim of faith?
Well yes, I do have faith, or belief,. of that I can say you are correct, however it is a personal thing rather than affiliated with social structures. Also, as a person who actively strives to find answers, I am most open to new material from all walks of life...I read around various schools of thought, scientific, theological, philosophical etc, so I don't claim to have any answers, rather im just a person searching for them like anyone else...I can tell someone what I believe, and why I believe it, however I cannot provide scientific evidence.Be interested in hearing how you reconcile the notion of a creator with Taoist philosophy. While Taoism has a fair amount in common with pantheism, in terms of creation the general gist is from nothing (wuji) comes substance (taiji) which divides into two forms (liang yi or yin and yang), the four emblems, eight trigrams (pakua), sixty four hexagrams (as in the i ching), and the ten thousand things. So basically division and subdivision leading to exponentially increasing complexity, which isn't a bad stab at things for 4th century BCE. Certainly no creator and very little in common with Abrahamic creation myths.
Now before we delve into any discussion about, Taoism, Tesla, electromagnetic frequencies, string theory, Taoist Philosophy, Neidan (Jing, Qi, Shen practives) Carl Jung, Vibrational frequencies, the esoteric, occult and all the other wondrous things we can speculate on...I do want to ask you...at what point did I mention anything about Abrahamic religions ?This is a complex topic and subject to a number of misconceptions but let's give it a go.
Before we begin I want to repeat the two major caveats outlined previously by OscarBravo, namely, the only honest answer to what caused/preceded the big bang is that we don't know and that since time is a property of our current universe, talking about what happened before time existed is meaningless.
However, we can posit possible scenarios for the cause of the big bang. In fact, the eventual fate of our current universe might give us a clue. The neatest possibility IMHO is the cyclical universe hypothesis outlined by Roger Penrose. It goes something like this.
Right now we are in the stelliferous era of the universe, the age of stars. Once stars such as our sun begin to burn out, the universe will eventually only consist of white dwarfs, brown dwarfs and black holes. At this point we will enter the degenerate era. During this time white dwarfs will assimilate dark matter and proton decay will begin leaving only black holes. Then we enter the black hole era. Over time, the black holes themselves, due to Hawking radiation, will evaporate. At this point the universe will only consist of massless particles travelling at the speed of light. This dark era will stretch on for eternity, as the temperature of the universe cools to zero, and the density approaches zero. But if you are travelling at the speed of light, an eternity is no different from an instant. Time, as a scale of duration, becomes meaningless. This is the heat death of the universe. At this point, the infinite eternity of one universe is no different, scientifically speaking, from the singularity beginning of the next universe. It is possible, and plausible, that the universe may exist in an infinite series of cycles with the death of each universe being the big bang of the next.
This isn't just a nice story. It is a coherent physical framework which fits within our current understanding of cosmology and quantum physics. Moreover, there has even been some preliminary experimental support for it:
Concentric circles in WMAP data may provide evidence of violent pre-Big Bang activity
On CCC-predicted concentric low-variance circles in the CMB sky
Data gathered from the Wilkinson Microwave Anisotropy Probe (WMAP) suggests that there are variances in the cosmic background radiation (CMB) consistent with a cyclic conformal rescaling.
For more basic explanations of this hypothesis you can read more here:
The Five Ages of the Universe
Heat death of the Universe
Conformal cyclic cosmology
There are also books on the subject, one dealing specifically with the hypothesis above:
Cycles of Time: An Extraordinary New View of the Universe
Like I said, at the beginning I like this hypothesis because it is a neat explanation. It covers all points while requiring few assumptions. It also has the benefit of some preliminary, very preliminary I hasten to add, experimental evidence.
This is a huge topic and I think a primer on it might help your understanding immensely.
The Hidden Reality: Parallel Universes and the Deep Laws of the Cosmos
However, there are several important points to take away from all this.
1. It is possible that the answer to the origin of the universe may be outside of our capacity to test, just like abiogenesis. We can propose theories and frameworks which fit our understanding of science but until we can go back in time and (in this case) outside our spacetime, we can't know which theory, if any, is correct. It's like discovering a murder victim after he's been cremated. You can hypothesise that he was stabbed or shot or smothered but there's no way to discern from the available evidence which theory is correct.
2. The answer "I don't know" is perfectly valid in this, or any other context. The fact that person A has their claim utterly refuted by person B doesn't require person B to offer an alternate explanation to replace A's broken idea.
3. God is a possible answer to the problem but one with no supporting evidence. Our current understanding of physics is such that we don't need to invoke a god to complete the theory or balance the equation if you will. You can still invoke God to answer all the things that science doesn't understand but that's not a very sound strategy.
Ill be the first to admit im not well versed in the realm of quantum physics, multiple universes and such, rather ive only begun to scratch the surface of such topics, so I will review the links, and continue wading my way through the vast body of literature..Thanks for the links
As you can see above, im of the opinion that understanding such phenomena to the point that we can form a valid explanation is far beyond our grasp at present, and will require a scientific revolution of sortsThanks for the support. I see no reason on a plain reading of Genesis to think that the Garden of Eden was anything but what it says on the tin ... a paradise on Earth.
It is both ... we are primarily made in the spiritual / intellectual image of God ... but He also took on our physical image when He incarnated on Earth, as Jesus Christ.
It often happens in relation to animals and inanimate objects.
I know all about this stuff ... but it always comes up short of its initial promise ... because it is not of God.
I could give you one..., Biblical literacy is a phenomenon that is little more than a century old
Bur JC, you've said he took on our image, that contradicts the point you tried to make doesnt it?
In what sense? I have yet to understand how these things fall short?0 -
Advertisement
-
-
-
-
These are examples of the quality of the pre-exsiting CFSI present within living organisms that they are able to intelligently produce novel abilities themselves ... its akin to a very sophisticated robot that can learn to produce novel things (an example of intelligent programming of intelligence into the robot) ... and not something spontaneously inherent in the physical/electrical systems in the robot.
Not sure how aware you are of cellular automata and self replicating automata, but we can observe some apparently complex problem solving behaviour without the need for complex programming, as illustrated in this article from Nature on slime mold solving a maze. Even in a system as simple as Conway's game of Life we see a vast array of forms appearing, evolving and stabilising or dying out all from about 100-150 lines of pretty simple code.
And for self replicating automata you need neither computers nor life, as can be seen by this rather old video (but IMHO excellent) video;
0 -
-
Yes indeed, when there is an intelligent input all these examples of complex specificity (and much more) are possible ... without an intelligent input they are all impossible.Not sure how aware you are of cellular automata and self replicating automata, but we can observe some apparently complex problem solving behaviour without the need for complex programming, as illustrated in this article from Nature on slime mold solving a maze. Even in a system as simple as Conway's game of Life we see a vast array of forms appearing, evolving and stabilising or dying out all from about 100-150 lines of pretty simple code.
And for self replicating automata you need neither computers nor life, as can be seen by this rather old video (but IMHO excellent) video;0 -
-
-
-
Advertisement
-
https://www.youtube.com/watch?v=0OOmSyaoAt0
https://www.youtube.com/watch?v=C2vgICfQawE
https://www.youtube.com/watch?v=2_9ohFWR0VsAdvertisement